
dru-withoutamap.blogspot.com
upside down in cloudIllustrator in Bristol, England. I blog local interest, poetry, wildlife, travel, and art. Also LGBT and gender politics!
http://dru-withoutamap.blogspot.com/
Illustrator in Bristol, England. I blog local interest, poetry, wildlife, travel, and art. Also LGBT and gender politics!
http://dru-withoutamap.blogspot.com/
TODAY'S RATING
>1,000,000
Date Range
HIGHEST TRAFFIC ON
Saturday
LOAD TIME
0.7 seconds
16x16
32x32
PAGES IN
THIS WEBSITE
19
SSL
EXTERNAL LINKS
291
SITE IP
172.217.6.65
LOAD TIME
0.68 sec
SCORE
6.2
upside down in cloud | dru-withoutamap.blogspot.com Reviews
https://dru-withoutamap.blogspot.com
Illustrator in Bristol, England. I blog local interest, poetry, wildlife, travel, and art. Also LGBT and gender politics!
upside down in cloud: poetry of Idris Davies
http://dru-withoutamap.blogspot.com/2009/07/poetry-of-idris-davies.html
Monday, 6 July 2009. Poetry of Idris Davies. There doesn't seem to be much of Idris Davies' poetry on the internet, so I've uploaded these, some of which are in "This World of Wales - an anthology of Anglo-Welsh poetry", ed. Gerald Morgan, and others gleaned here and there. You might also like this poem. By Meic Stephens, about colliery hooters; I do! And here is Alabaster Thomas. My own Valleys poem). Do you remember 1926? That summer of soups and speeches,. Do you remember 1926? Do you remember 1926?
upside down in cloud: wild times on the canal
http://dru-withoutamap.blogspot.com/2015/07/wild-times-on-canal.html
Monday, 20 July 2015. Wild times on the canal. Dawn near Semington. The roe hind raises her head and sweeps the horizon with the radar dishes of her ears. The fox is a red periscope surfacing from the thistles. A wood pigeon porpoises across the gulf of meadow. Fax and teletext messages burst in turn from the skylark and sedge warbler. The hind examines a pair of cock pheasants who are quarrelling; she leaps back when they remonstrate with her; retreats a few paces, then edges forward again. The hind app...
upside down in cloud: Kultur wars on the canal
http://dru-withoutamap.blogspot.com/2015/07/kultur-wars-on-canal.html
Monday, 27 July 2015. Kultur wars on the canal. When I was a lad, I’m sorry to say,. My chance to join the Navy sadly slipped away. I worked instead selling clapped out motors,. Safe and sound a long way from such dang’rous waters. Safe and sound a long way from such dang’rous waters). Safe and sound, I say, till, upon a whim. I bought a boat cos I’m a fan of Rosie’n Jim. He bought a boat cos he’s a fan of Rosie’n Jim). A marina berth I swiftly found,. And my gangplank very soon was rooted to the ground.
upside down in cloud: November 2014
http://dru-withoutamap.blogspot.com/2014_11_01_archive.html
Saturday, 29 November 2014. Dhobi day on the boat. An article in the Guardian. A couple of weeks ago looked at people who live on boats, particularly in London, as a solution to the housing crisis of availability and expense. A couple of comments I read as a response to the article reckoned that boat dwellers are smelly, which accords with my (thankfully limited) experience of the attitude that some people have to boaters as some sort of underclass, disreputable and probably on drugs, yadda yadda. Friday...
upside down in cloud: August 2015
http://dru-withoutamap.blogspot.com/2015_08_01_archive.html
Monday, 24 August 2015. It's nearly two years since the publication of Inking Bitterns. An anthology that combined poetry and pictures on the subject of wildness. Now, Gert Macky Books (population: 1) is getting ready for a new anthology. It will be produced in what is already recognisably the Gert Macky style, which is to say AT THE VERY LAST MOMENT. It's intended to be launched at the Bristol Poetry Festival, on 29th September. We could do with a few more poems. Links to this post. Built for Trinity Ho...
TOTAL PAGES IN THIS WEBSITE
19
Musings of an I.T. Girl: January 2015
http://stacy-it.blogspot.com/2015_01_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Saturday, 3 January 2015. 2014 - what a mixed bag! It's been a couple of months since I posted anything here. There is a good reason for that (and for me being so quite in the comment sections of others blogs! But I'll come to that later. January started with the broken boiler a week or two before my son was due to be born. Stress and very likely an overpriced boiler later we had heating (and no CO) again! Sadly, this was not...
Musings of an I.T. Girl: August 2014
http://stacy-it.blogspot.com/2014_08_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Sunday, 31 August 2014. Excuse typos this is not going to be much proof readong). Without looking at the date of the last post I know that it has been a couple of months since I last posted. There are a few reasons, trying to cut down on what I am doing and spend time not looking at a couple of million liquid crystals (not really working), being exhausted and just really not in a place to write. It was caught early and should...
Musings of an I.T. Girl: June 2014
http://stacy-it.blogspot.com/2014_06_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Thursday, 26 June 2014. Well, after a various delays caused by my private life I have just called the hospital to say I am ready to go on the waiting list. At the start of July I have to speak to a psychologist as you need to have spoken to one from the gender team less than 6 months before the operation and I have to have another appointment with the anesthetists as my last appointment was too long ago to be considered valid.
Musings of an I.T. Girl: Recovery and reflection
http://stacy-it.blogspot.com/2015/04/recovery-and-reflection.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Saturday, 25 April 2015. Wow, I just saw on Lynn's blog. That my last post was 3 months ago! Time flies, hey? So, what has been happening? Well, a lot! I'm going to start with the bad news and try to end well. I had all 4 of my grandparents until I was in my early twenties. I thankfully still have 3. And it hurts to think that he won't have that. Maybe the loss is more mine than his, but it hurts, A lot. And am building my ow...
Musings of an I.T. Girl: March 2014
http://stacy-it.blogspot.com/2014_03_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Saturday, 29 March 2014. Time flies when you are simply looking at your son and smiling! I may not have much time to write this - as I type I can see my son waking up on the video monitor. I think that he wants to watch F1 qualifying with me :p. We are starting to get into a rhythm during the evening but over the daytime he is still doing his own thing. Poor Mrs Stace struggles most with that though as I have to go to work.
Musings of an I.T. Girl: May 2014
http://stacy-it.blogspot.com/2014_05_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Wednesday, 21 May 2014. Wow, customer service. I just got off of the phone with my cable provider as a very happy bunny. (How often do you hear that! Our cable recorder just died on us. First it turned off, then it wouldn't turn on. Even after being physically removed from the power for a couple of minutes. OK, then 15 minutes. Fine Menu. Systems. WTF - the option to rescan the channels has greyed itself out! Er, yes please!
Musings of an I.T. Girl: April 2015
http://stacy-it.blogspot.com/2015_04_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Saturday, 25 April 2015. Wow, I just saw on Lynn's blog. That my last post was 3 months ago! Time flies, hey? So, what has been happening? Well, a lot! I'm going to start with the bad news and try to end well. I had all 4 of my grandparents until I was in my early twenties. I thankfully still have 3. And it hurts to think that he won't have that. Maybe the loss is more mine than his, but it hurts, A lot. And am building my ow...
About Angie: November 2016
http://aboutangiekay.blogspot.com/2016_11_01_archive.html
Tuesday, 29 November 2016. A small group of friends at a recent Ukulele Fun Night. I'm on the left,. With Cherry next to me. The lady on the far right is Jean, another. Slimming World member, so we have more than ukes in common. The acceptance and encouragement that's come my way are tremendous and I've made lots of lovely new friends. In gratitude, I tried to put something back into the group by volunteering to keep our song book up to date. More recently, I offered to resurrect my former websit...Posse...
About Angie: Slimming World success
http://aboutangiekay.blogspot.com/2016/12/slimming-world-success.html
Friday, 23 December 2016. 24 weeks after joining Slimming World, I have shed 2 stone, 9½ pounds and not only achieved my target weight but gone a pound beyond it. Weight once on my Slimming World journey. Then there are the certificates, marking important stages on the journey and proudly displayed on a notice board in my hobby room. Apart from that final Certificate of Success, this has to be the one for which I'm most proud, not least because it was unexpected. I'm thrilled that two friends have joined...
Musings of an I.T. Girl: October 2014
http://stacy-it.blogspot.com/2014_10_01_archive.html
Musings of an I.T. Girl. Random ramblings from a girl who loves IT and gadgets. Saturday, 11 October 2014. Just not had much time to get a post actually finished! I have started a couple. One still to come, and another that has just been deleted. I was on far too much of a downer when writing it and it was too much. Waiting to see if any tickets come in). The doctor originally thought it was a bad cold as he had a running nose, was coughing and wheezing a little. The temperature dropped over the followin...
TOTAL LINKS TO THIS WEBSITE
291
Dru-typing.org
February 1st, 2018. WELCOME TO THE DRU TYPING WEB PAGE. As of 01 February, 2018 the. 1 to 23 repeats. Click here to go to the search page. Variable-number tandem repeat (VNTR) sequences have found important use in the epidemiological typing of problem bacterial pathogens. In methicillin-resistant. MRSA), the direct-repeat unit (. VNTR region adjacent to IS. Publication of the typing approach and nomenclature can be found at:. Associated direct repeat unit (. Forward primer 5’ GTTAGCATATTACCTCTCCTTGC 3’.
Dru Yoga Venlo
Welkom bij Dru Yoga Venlo. Voor up-to-date informatie wordt je doorverwezen naar Dhruva yoga en meditatie. 2008 - 2014 www.dru-venlo.org Contact.
Dru-vid (Damien) - DeviantArt
Window.devicePixelRatio*screen.width 'x' window.devicePixelRatio*screen.height) :(screen.width 'x' screen.height) ; this.removeAttribute('onclick')" class="mi". Window.devicePixelRatio*screen.width 'x' window.devicePixelRatio*screen.height) :(screen.width 'x' screen.height) ; this.removeAttribute('onclick')". Join DeviantArt for FREE. Forgot Password or Username? Deviant for 9 Years. This deviant's full pageview. Last Visit: 5 weeks ago. This is the place where you can personalize your profile! Got a new...
Design Research Unit Wales
Design Research Unit w. King Edward VII Ave. Email: dru@cf.ac.uk. Valid XHTML 1.0. Designed and managed by ws.
upside down in cloud
Thursday, 22 March 2018. Attack of the Trans Cabal. Inspired, obviously, by Stephen Collins' rather wonderful cartoon. You may need to click on it to get it big enough to read. Links to this post. Thursday, 15 March 2018. A new pictorial map of the West of England. In desktop publishing, hem hem. Observe the pile of books squashing the drawing flat in the scanner. Links to this post. Poets afloat at Seend. Normally, a poetry audience looks really miserable in photos. This must have been a funny poem.
www.DRU-WYD.sk
Nitra KARIN Z KLICPEROVA CHLUMCE. Nitra KARIN Z KLICPEROVA CHLUMCE. Nitra KARIN Z KLICPEROVA CHLUMCE. Raquo; Galery scottish terrier. Raquo; Galery SHS. DRU-WYD Scottish terrier kennel, Točnica 138, 985 22 Cinobaňa, Slovakia.
Dru Yoga Wageningen
Dru Yoga Wageningen welkom op mijn site. Welkom op de site van Dru Yoga Wageningen. Kijk gauw verder, om een indruk te krijgen van Dru Yoga en wat de mogelijkheden zijn voor lessen. In de laatste week van augustus 2016 hebben we weer een yoga- vakantie/ontspanningsweek in Frankrijk, klik hier. Voor vragen en informatie kunt u mailen naar. Geregistreerd Dru Yoga docent.
Nataraj Dru Yoga | Centrum voor Innerlijke ontwikkeling en Dru Yoga | Driebergen | Utrechtse Heuvelrug | Liselotte Hennekam |
dru-yoga.nl
Nataraj Dru Yoga | Centrum voor Innerlijke ontwikkeling en Dru Yoga | Driebergen | Utrechtse Heuvelrug | Liselotte Hennekam |
SOCIAL ENGAGEMENT