gr0w.wordpress.com
gr0w | a new sound installation by Robert Jarvisa new sound installation by Robert Jarvis
http://gr0w.wordpress.com/
a new sound installation by Robert Jarvis
http://gr0w.wordpress.com/
TODAY'S RATING
>1,000,000
Date Range
HIGHEST TRAFFIC ON
Tuesday
LOAD TIME
0.7 seconds
16x16
32x32
PAGES IN
THIS WEBSITE
16
SSL
EXTERNAL LINKS
47
SITE IP
192.0.78.12
LOAD TIME
0.655 sec
SCORE
6.2
gr0w | a new sound installation by Robert Jarvis | gr0w.wordpress.com Reviews
https://gr0w.wordpress.com
a new sound installation by Robert Jarvis
figure-figure | gr0w
https://gr0w.wordpress.com/2006/11/30/juxtapositions
A new sound installation by Robert Jarvis. The garden, of course, is not a neutral environment. Its soundscape is in a constant flux of change appropriate to the time of year. Certainly, the sounds will be different in May and over the summer (when what I create will be exhibited). This, of course, presents its own challenges as I experiment with what the final result might sound like. This entry was posted on 30 November, 2006 at 9:37 pm and is filed under Blogroll. Feed You can leave a response. Build ...
audio box | gr0w
https://gr0w.wordpress.com/2007/04/30/audio-box
A new sound installation by Robert Jarvis. Laquo; final mix. The sound for the installation will be ‘played’ from a specially made audio box capable of playing and amplifying four synchronised channels of audio to be sent to the loudspeakers around the pond. The device turns on and automatically begins playing when the garden’s electricity is turned on in the mornings, and then loops until the power is switched off. This entry was posted on 30 April, 2007 at 4:43 pm and is filed under Blogroll.
musical dna | gr0w
https://gr0w.wordpress.com/2007/01/28/musical-dna
A new sound installation by Robert Jarvis. Laquo; acoustic perfume. I am currently experimenting with sonifying the DNA strings of various plants in the garden. Because of the repetition in the data the effect can sound quite musical. As an example, here is what one of the gardens plants (Indian Bean Tree) sounds like: LISTEN. And here’s the DNA data: –. GAATCAATCCTACTACTTCTGGTTCNNNNGNNNCCACGCTTGAAAAAAAAAACC TGGGGCGTATCGTCCAAATCATCGGTCCGGTAMTAGATGTAGCCTTTCCGCCGG GCAAGATGCCTAATATTTATAACGCTCTAGTAGTTAAAGGTC...
final mix | gr0w
https://gr0w.wordpress.com/2007/04/25/final-mix
A new sound installation by Robert Jarvis. This entry was posted on 25 April, 2007 at 8:36 pm and is filed under Blogroll. You can follow any responses to this entry through the RSS 2.0. Feed You can leave a response. From your own site. Leave a Reply Cancel reply. Enter your comment here. Please log in using one of these methods to post your comment:. Address never made public). You are commenting using your WordPress.com account. ( Log Out. You are commenting using your Twitter account. ( Log Out.
the finer detail | gr0w
https://gr0w.wordpress.com/2006/10/31/19
A new sound installation by Robert Jarvis. Laquo; nature’s phrases. This entry was posted on 31 October, 2006 at 2:58 pm and is filed under Blogroll. You can follow any responses to this entry through the RSS 2.0. Feed You can leave a response. From your own site. Leave a Reply Cancel reply. Enter your comment here. Please log in using one of these methods to post your comment:. Address never made public). You are commenting using your WordPress.com account. ( Log Out. Notify me of new comments via email.
TOTAL PAGES IN THIS WEBSITE
16
paradise revealed | robert jarvis
https://robertjarvis.wordpress.com/2008/03/28/paradise-revealed
Sound and the city. Laquo; the magic hour. March 28, 2008. I have been asked to create two pieces as part of a group show in response to two locations in the Dover area: the Pines Calyx Gardens and also the Charlton Centre Multi-Storey Car Park. The completed works will be at both locations between May 14th and July 13th, 2008, and I will be keeping a blog documenting my process at http:/ paradiseRevealed.wordpress.com. This entry was posted on March 28, 2008 at 1:25 pm and is filed under Uncategorized.
PR's Album: 06/22/13
http://pralbum.blogspot.com/2013_06_22_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Saturday, June 22, 2013. Slowly, but surely, work on Alembic continues with more minor revisions - the odd tweaking of text here, the repositioning of a graphic there - and decisions on final generic content, such as descriptions, Alembic numbers, barcodes and. promotion.
PR's Album: Card Music 2013 - origins and futures
http://pralbum.blogspot.com/2013/12/card-music-2013-origins-and-futures_21.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Saturday, December 21, 2013. Card Music 2013 - origins and futures. Card music 2013: 'the snow globe' (free music). Memory plays funny tricks. After working on my most recent PMusic composition the snow globe. I named Carol Cloud. This was an exploration of the possibilities of harmonie...
gr0w | robert jarvis
https://robertjarvis.wordpress.com/2006/07/11/hello-world
Sound and the city. Laquo; sound and the city. July 11, 2006. From September I will embark on an eight-month residency in association with the Hannah Peschar Sculpture Garden. During my time there I will take inspiration from the garden, specifically in relation to the growth of the plants, to create a sound installation for the garden’s 2007 season, which runs from May to the end of October. A project weblog will be kept at www.gr0w.wordpress.com. Leave a Reply Cancel reply. Enter your comment here.
PR's Album: 04/30/13
http://pralbum.blogspot.com/2013_04_30_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Tuesday, April 30, 2013. I was originally going to publish 82 scores. Solely as a paperback in colour but, on reflection, felt it would be best for it to be part of the initial b&w quartet I am going to publish in July. This also keeps it in line with the cost of the other paperbacks.
PR's Album: 12/21/13
http://pralbum.blogspot.com/2013_12_21_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Saturday, December 21, 2013. Card Music 2013 - origins and futures. Card music 2013: 'the snow globe' (free music). Memory plays funny tricks. After working on my most recent PMusic composition the snow globe. I named Carol Cloud. This was an exploration of the possibilities of harmonie...
PR's Album: 04/14/12
http://pralbum.blogspot.com/2012_04_14_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Saturday, April 14, 2012. The Rising of the Titanic. I recommend this record - the first on Brian Eno's Obscure Records label. A large inspiration for me in itself) - both for the title track and the piece 'on the other side': 'Jesus Blood Never Failed Me Yet'. Directors Howard Rees and...
PR's Album: P
http://pralbum.blogspot.com/2014/01/p.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Friday, January 03, 2014. Subscribe to: Post Comments (Atom). Promote your Page too. Consemble - 'Open Compositions' venture. Magic Stones CD album. Robert Jarvis: Chongqing Diary. Cheryl E Leonard (Music From The Ice). Sound is Audible Time. The Science of Sound. Everybody is in process.
PR's Album: 12/01/14
http://pralbum.blogspot.com/2014_12_01_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Monday, December 01, 2014. Card Music 2014: Calender Music. Here is this year's card music in the form of a Calender MusicBook:. Http:/ www.alembicbooks.co.uk/card music.html. Links to this post. Subscribe to: Posts (Atom). Promote your Page too. Card Music 2014: Calender Music.
PR's Album: 01/03/14
http://pralbum.blogspot.com/2014_01_03_archive.html
PR's Album is the Blog of artist/composer Paul Ramsay, primarily documenting the creative ideas and processes involved in developing 'Chameleon Lectra' and its record label 'Motile' and publishing imprint 'Alembic Books'. Friday, January 03, 2014. Links to this post. Subscribe to: Posts (Atom). Promote your Page too. Consemble - 'Open Compositions' venture. Magic Stones CD album. Robert Jarvis: Chongqing Diary. Cheryl E Leonard (Music From The Ice). Sound is Audible Time. The Science of Sound.
TOTAL LINKS TO THIS WEBSITE
47
Blog de Gr0w-up-xx - Blog de Gr0w-up-xx - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. It's My bloug. Je suiiiiis com' saa. Mise à jour :. Abonne-toi à mon blog! Ta ocune idée a kel poin jt'eiime. N'oublie pas que les propos injurieux, racistes, etc. sont interdits par les conditions générales d'utilisation de Skyrock et que tu peux être identifié par ton adresse internet (54.145.69.42) si quelqu'un porte plainte. Ou poster avec :. Retape dans le champ ci-dessous la suite de chiffres et de lettres qui apparaissent dans le cadre ci-contre.
Blog de gr0w-up - Beauty always comes with dark thoughts... <3 - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. Beauty always comes with dark thoughts. 3. Mise à jour :. BOUH * * *. Abonne-toi à mon blog! Posté le jeudi 28 juin 2007 09:00. Poster sur mon blog.
Blog de gr0w-upp - 0Oupss! - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. Il est exactement 21h43 et j'ai faim . Mise à jour :. LEAVIN ' (DEPARTURE). Abonne-toi à mon blog! CeBlogMeSoolDoncChangement. → ●. N'oublie pas que les propos injurieux, racistes, etc. sont interdits par les conditions générales d'utilisation de Skyrock et que tu peux être identifié par ton adresse internet (67.219.144.170) si quelqu'un porte plainte. Ou poster avec :. Posté le jeudi 21 février 2008 15:58. Modifié le samedi 02 août 2008 17:44.
Index of /
22-Jul-2014 11:35 4.0K CONTRIBUTING.md. 22-Jul-2014 11:35 2.1K LICENSE.md. 22-Jul-2014 11:35 1.8K README.md. 22-Jul-2014 11:35 1.8K admin/. 22-Jul-2014 11:32 - css/. 22-Jul-2014 11:32 - favicon.gif. 24-Jul-2014 14:12 0 favicon.ico. 24-Jul-2014 14:12 0 images/. 22-Jul-2014 11:33 - includes/. 22-Jul-2014 11:34 - js/. 22-Jul-2014 11:35 - pages/. 22-Jul-2014 11:35 - readme.html. 22-Jul-2014 11:35 36K sample-public-api.txt. 22-Jul-2014 11:35 356 sample-public-front-. 22-Jul-2014 11:35 132 user/.
gr0w | a new sound installation by Robert Jarvis
A new sound installation by Robert Jarvis. 12 May, 2007. With the audio box now installed, my sound installation is now complete. It has been running now at the garden for over a week, in rain, wind and sunshine and everything seems to be working as it should. After such a long project it feels good to have come to an end as now my mind can rest (before turning to my next project – for La Cité des Insectes. 30 April, 2007. 25 April, 2007. 31 March, 2007. 29 March, 2007. An interesting challenge is trying...
Homepage - Legging Co. | Printed Leggings | Jean Leggings | Jeggings | Harem Pants | Leather Leggings | Fleece Leggings | Velvet Leggings
Error Page cannot be displayed. Please contact your service provider for more details. (7).
Blog de gr0win-up - Am0ur, Sexe, M0rt, Passi0n, Peur, 0bsession - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. Am0ur, Sexe, M0rt, Passi0n, Peur, 0bsession. Qui gobe une noix de coco. Fait confiance à son anus =). Mise à jour :. Requiem For a Dream (Requiem For A Dream). Abonne-toi à mon blog! N'oublie pas que les propos injurieux, racistes, etc. sont interdits par les conditions générales d'utilisation de Skyrock et que tu peux être identifié par ton adresse internet (23.21.86.101) si quelqu'un porte plainte. Ou poster avec :. Posté le dimanche 17 février 2008 16:32.
Blog de GR0WING--UP - Evidemment ! - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. 10&11/11/08 : MÉRCI PÀTÀTE =)(L). Design by GR0WING- UP. Mise à jour :. Abonne-toi à mon blog! Ce blog n'a pas encore d'articles. Poster sur mon blog.
Blog de gr0wing-up - People change . I changed . Yes..i'm gr0wing up ! - Skyrock.com
Mot de passe :. J'ai oublié mon mot de passe. People change . I changed . Yes.i'm gr0wing up! Just appreciate Life as I sh0uld . Keep in my memory all moments that matter and F@#K the rest! Mise à jour :. Abonne-toi à mon blog! I know who i am, i know what i want and what i have . For me, i love my ( true. Friends, family and Boyfriend. I changed and i don't regret. What i became. Actually, i love who i am. Things, found some solutions to my problems. And understood how i can appreciate. Ou poster avec :.
gr0wing.com - Think, Improve, Change the world in the process.
Think, Improve, Change the world in the process. Coders can change the world. I spent much less time writing last year, and many of you kindly reminded me that it was not acceptable. I get it. And I have no excuse to shield my pride. I wrote little and this is lame, I … [Read more.]. Getting Old is More Than Just Getting Old. Sober Living and Dealing With The Aftermath of Addiction. Addiction is a Disease. Now What? How to blog when you’re broke, weird and enthusiastic. 8220;Until the soldiers of peace b...