sepidermidis.mlst.net
Staphylococcus epidermidis - Organismal Information
http://sepidermidis.mlst.net/earth
View geographical locations of isolates in the database and details regarding Sequence Types per country. Click the Google icon to view Staphylococcus epidermidis. A Javascript enabled browser is required. An Installation of Google Earth is required.
sepidermidis.mlst.net
Staphylococcus epidermidis - Links
http://sepidermidis.mlst.net/misc/links.asp
sepidermidis.mlst.net
Staphylococcus epidermidis - Organismal Information
http://sepidermidis.mlst.net/misc/info.asp
Multilocus sequence typing of Staphylococcus epidermidis. PCR Conditions and Sequencing. Determining Allelic Numbers and Sequence Types. Comparison of Isolates With the S. epidermidis. Has become a leading cause of nosocomial infections. Its ability to produce a thick, multilayered biofilm allows S. epidermidis. Remains a clinically important pathogen. Three MLST schemes were previously available for S. epidermidis. Two of which were published during the same month by Wang et al. And Wisplinghoff et al.
sepidermidis.mlst.net
MLST - Unique profile treedraw
http://sepidermidis.mlst.net/eburst
Click here to see new features in Version 3. Please make a choice -. Enter your own profile data. Run eBURST on the entire. To download the entire eBURSTv3 readme as .pdf. Or for full instructions and Readme please visit http:/ eburst.mlst.net.
saureus.mlst.net
MLST - Unique profile treedraw
http://saureus.mlst.net/eburst
Click here to see new features in Version 3. Please make a choice -. Enter your own profile data. Run eBURST on the entire. To download the entire eBURSTv3 readme as .pdf. Or for full instructions and Readme please visit http:/ eburst.mlst.net.
ssuis.mlst.net
Streptococcus suis - Organismal Information
http://ssuis.mlst.net/misc/info.asp
Primers and PCR conditions for MLST of S.suis. Internal fragments of the 5-enolpyruvylshikimate 3-phosphate synthase (aroA), 60 KDa chaperonin (cpn60), peroxide resistance (dpr), glucose kinase (gki), DNA mismatch repair protein (mutS), homologous recombination factor (recA) and aspartokinase (thrA) genes were amplified by PCR using the following primer pairs. AroA-up 5’ TTCCATGTGCTTGAGTCGCTA 3’ and. AroA-dn 5’ ACGTGACCTACCTCCGTTGAC 3’. Cpn-up 5’ TTGAAAAACGTRACKGCAGGTGC 3’and. King, S.J., Leigh, ...The S...
bhenselae.mlst.net
MLST - Unique profile treedraw
http://bhenselae.mlst.net/eburstv3
New features in eBURSTv3 are as follows -. JAVA Webstart implementation -allowing local install. Implementation of MultilocusML allowing comprehensive database integration and querying based on eBURST groups. Ability to upload and differentially display user strains against strains within the. Please make a choice -. Run eBURST on the entire. Enter your own profile data for direct comparison against database strains. To download the entire eBURST readme as .pdf.
bhenselae.mlst.net
MLST - Unique profile treedraw
http://bhenselae.mlst.net/sql/uniquetree.asp
Draw tree using own MLST data. For Instructions click -. Paste your data in comma-delimited format as follows:-. Strain A,4,5,6,4,7,9,10,1. Strain B,1,1,2,4,3,3,18,7. Strain C,3,4,5,6,7,9,23,9. WARNING - You must have no spaces on either side of your data. Please submit the form once then click to draw a tree. Please enter your query -.