crispr-cas9.com
CRISPR tools and Resources - One-stop place for CRISPR-cas Genome Editing Tools and Resources
CRISPR Biological Tape: Recording Cellular Events Over Time. Published on November 27, 2017. Synthetic biologists have previously used CRISPR to store poems, books, and images in DNA, but now researchers for the first time used CRISPR to record cellular activity and the timing of those events. Read more ». A Molecular Switch for CRISPR: Anti-CRISPR. Published on March 28, 2017. CRISPR-mediated gene editing using small molecules. Published on February 6, 2015. Published on December 16, 2014. Synthetic bio...
crispr-congress.com
CRISPR Congress 2017| Hanson Wade
Pricing & Venue. Optimize your CRISPR Design to Efficiently Power Novel Applications in Drug Discovery, Screening and Therapeutic Development. 3rd Annual CRISPR Precision Genome Editing Congress Boston. Will once again unite academia, pharma, biotech and technology providers to optimize the adoption of CRISPR gene editing and pioneer further advances within biomedical research, drug discovery, R&D and therapeutic development. Cut through the avalanche of publications. T: 44 (0)20 3141 8700.
crispr-on.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-on.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tf.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tf.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tfs.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tfs.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr.dbcls.jp
CRISPRdirect
Mdash; Rational design of CRISPR/Cas target. Or Paste a nucleotide sequence:. Sample sequence atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatg...
crispr.i2bc.paris-saclay.fr
CRISPR home page
Cas Genes at TIGR. CRISPR plasmids for academic lab research at Addgene. CRISPR evolution ( Yersinia pestis. CRISPRs found ( *. Number of convincing CRISPR structures (number of genomes with such CRISPR). This web site is the product of an original work by Ibtissem Grissa ( PhD thesis Paris University. And is presently developed by Christine Drevet. A web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007 May 31. General purpose of this site. Itself, in wh...
crispr.med.harvard.edu
sgRNA Scorer 1.0
Church lab CRISPR resources. SgRNA Scorer 1.0. SgRNA Scorer 1.0. We have also made available a pre-computed list of sites derived using CasFinder and scored with sgRNA Scorer for the entire human and mouse exomes for both Cas9 orthologs. This can be found here. Please use a working e-mail address as a link to a file with results from sgRNA scorer will be emailed to you as soon as it's done. The file will be retained for 24 hours. S pyogenes (PAM: NGG). S thermophilus (PAM: NNAGAAW).