crispr-on.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-on.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tf.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tf.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tfs.com
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr-tfs.org
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
crispr.dbcls.jp
CRISPRdirect
Mdash; Rational design of CRISPR/Cas target. Or Paste a nucleotide sequence:. Sample sequence atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatg...
crispr.i2bc.paris-saclay.fr
CRISPR home page
Cas Genes at TIGR. CRISPR plasmids for academic lab research at Addgene. CRISPR evolution ( Yersinia pestis. CRISPRs found ( *. Number of convincing CRISPR structures (number of genomes with such CRISPR). This web site is the product of an original work by Ibtissem Grissa ( PhD thesis Paris University. And is presently developed by Christine Drevet. A web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007 May 31. General purpose of this site. Itself, in wh...
crispr.med.harvard.edu
sgRNA Scorer 1.0
Church lab CRISPR resources. SgRNA Scorer 1.0. SgRNA Scorer 1.0. We have also made available a pre-computed list of sites derived using CasFinder and scored with sgRNA Scorer for the entire human and mouse exomes for both Cas9 orthologs. This can be found here. Please use a working e-mail address as a link to a file with results from sgRNA scorer will be emailed to you as soon as it's done. The file will be retained for 24 hours. S pyogenes (PAM: NGG). S thermophilus (PAM: NNAGAAW).
crispr.sigmainformatics.com
CRISPR/Cas gRNA Designs
Order Oligos and Peptides. Product and Process Development. Safety and Regulatory Information. New Lab Start-Up Program. Search CRISPR/Cas gRNA designs. Review and Email Order. Ordering and Design Guidelines. 1) Search by Gene Symbol, mRNA RefSeq, or Gene ID. 2) Searches are performed on the highlighted tab only. 3) Search for up to 10 terms at one time. Option 1 : Enter Gene Symbol(s). Option 2 : Upload from template. Option 1 : Enter RefSeqs(s). Option 2 : Upload from template. We recommend screening 4...
crispr.u-psud.fr
Maintenance
Le site est desormais accessible a l'adresse suivante :. Http:/ crispr.i2bc.paris-saclay.fr.